NOVELTY – Deoxyribonucleic acid sequence comprises 19 nucleobases (SEQ ID NO: 1). USE – Deoxyribonucleic acid sequence used for detecting tumor protein p53 R337H allele (claimed) related to tumor of adrenal cortex. DETAILED DESCRIPTION – Deoxyribonucleic acid sequence comprises 19 nucleobases i.e. cctcctctgttgctgcaga (SEQ ID NO: 1). An INDEPENDENT CLAIM is included for a kit, which comprises deoxyribonucleic acid sequence (SEQ ID NO: 1), 22 nucleobases i.e. cctcattcagctctcggaacat (SEQ ID NO: 2), 15 nucleobases i.e. cgtgagcgcttcgag (SEQ ID NO: 3) and 15 nucleobases i.e. cgtgagcacttcgag (SEQ ID NO: 4), PCR reagents, tris(hydroxymethyl)aminomethan-EDTA buffer, positive control and negative control.
B04 (Natural products and polymers. Including testing of body fluids (other than blood typing or cell counting), pharmaceuticals or veterinary compounds of unknown structure, testing of microorganisms for pathogenicity, testing of chemicals for mutagenicity or human toxicity and fermentative production of DNA or RNA. General compositions.); D16 (Fermentation industry – including fermentation equipment, brewing, yeast production, production of pharmaceuticals and other chemicals by fermentation, microbiology, production of vaccines and antibodies, cell and tissue culture and genetic engineering.)